专利摘要:
The disclosed edge-blocker oligonucleotide based AS-NEPB-PCR method amplifies allele specific DNA (or RNA) while dramatically blocking amplification of wild type (WT) DNA (or RNA). The AS-NEPB-PCR design allows ready modification of an existing PCR reaction setup with an edge-blocker oligonucleotide together with an allele specific primer complementary to the mutant sequence to achieve allele specific amplification. The method simplifies assay optimization procedures and achieved sensitivity sufficient to detect a signal present at 0.1% level with close to 100% specificity, which is useful in detecting SNP or genetic mutations. The method was used to detect three different genetic mutations in cancer, in KRAS, BRAF, and EGFR, with three different types of modified edge-blocker oligonucleotides (phosphate, inverted dT and amino-C7). It was possible to detect one copy of mutant DNA in 1000-copy of normal DNA background of a heterogeneous sample, and was far more sensitive than the other blocking method.
公开号:AU2013221642A1
申请号:U2013221642
申请日:2013-02-13
公开日:2014-09-25
发明作者:Yuqiu Jiang;Haiying Wang;Yixin Wang
申请人:Janssen Diagnostics LLC;
IPC主号:C12Q1-68
专利说明:
WO 2013/123031 PCT/US2013/025913 1 Highly Sensitive Method for Detecting Low Frequency Mutations 5 BACKGROUND 10 Use of molecular assays is increasing rapidly in the diagnostic field. Molecular testing has been utilized by clinical scientists and physicians for better understanding of patient disease profiles as well as resistance to diseases at the molecular level. In particular, genetic differences between individuals are considered to be significant factors in evaluating response to treatment or 15 disease and determine response to therapy. The holy-grail in treating many diseases is to target particular aberrant and harmful cell types. Often such aberrant cells display mutations not present in the surrounding normal tissue. This is particularly true in the case of cancer where actual clones of cancerous cells may be far fewer in number than the 20 normal cells in the surrounding normal tissue. Sometimes, and with increasing success, such aberrant cells can be targeted by therapies before they expand provided their presence is detectable. Thus, in combination with clinical parameters molecular profiles can be used to assist in selecting a treatment for a patient, predicting the response of a patient to a particular therapy or predict 25 the disease-free and overall survival for a patient. In evaluating disease conditions like cancer, a patient may harbor cells that have one or more single point substitution, insertion, or deletion mutations that play a deleterious role. Different patients may have different mutations even when having the same 'type' of cancer. Each mutation or group of 30 mutations may be best treated by different therapeutic regimes. But, such point mutations are often far more difficult to detect than large insertions or deletions or germ line mutations since they are camouflaged by normal tissue which yields a large signal due to the identity of virtually all of nucleic acid sequence flanking the mutation site with genetic material obtained from surrounding normal tissue 35 in a sample. In other words, a sample of tissue including some cancerous tissue but also much normal tissue will, upon using Polymerase Chain Reaction ("PCR") techniques, generally yield a signal corresponding to normal tissue rather than the mutant sequence.
WO 2013/123031 PCT/US2013/025913 2 Although with a sensitive technique like PCR, the usual admonition is to adopt special laboratory practices to avoid false positive amplifications because the high throughput and repetition of PCR assays can lead to amplification of a single DNA molecule. When the signal is buried in a sea of almost identical 5 nucleic acid molecules additional technical problems need to be addressed to avoid amplifying the background of almost identical nucleic acid molecules instead of the desired target nucleic acid molecules because the background signal is due to molecules that have the advantage of numbers. As a result, a PCR based amplification may simply not readily amplify the nucleic acid variant 10 present at a low frequency-typically present in a tumor cell since the variant is often present at a much lower level than normal tissue in a sample (often at just a fraction of a percent)-when attempting early detection of a cancer or detection and monitoring by relatively non-invasive means. Utility of such an assay often depends to a great degree on successfully 15 segregating cancerous tissue from normal tissue to enrich for the target nucleic acid variant before conducting a genotype analysis or on adopting procedures that greatly favor amplification of the target nucleic acid molecule instead of an almost identical sea of background molecules. Examples of such techniques are described by, for instance, Newton et al. in "Analysis of any point mutation in 20 DNA: The amplification refractory mutation system (ARMS)" Nucleic Acids Res. 17:2503-2516 (1989). Sensitivity of such a technique may be expressed in terms of its sensitivity. A sensitivity of 1% indicates an ability to amplify and generate a signal corresponding to a target mutant molecular species present at a level of 1:100 in a sea of almost identical background normal copies. 25 A promising technique useful in the context of cancer is Allele-Specific amplification using Real-Time Polymerase Chain Reaction technology ("AS-RT PCR") that suppresses the amplification of the wild type sequence using a blocker oligonucleotide that preferentially binds to the wild type sequence to suppress its amplification relative to a variant of the wild type sequence. This 30 technique helps evaluate genetic mutations present at a low frequency in a patient-such as in tumor cells or in a chimera. This technique can help detect genetic variants, single nucleotide polymorphisms (SNP) and genetic mutations present at low frequency-as is demonstrated herein later. Example of AS-RT-PCR protocols and their limitations are described in, for 35 instance, Morlan et al. "Mutation Detection by Real-Time PCR: A Simple, Robust and Highly Selective Method", PLoS ONE 4(2): e4584. doi:10.1371/journal.pone.0004584(2009). The Morlan reference describes the use of center-blocker oligonucletides to enhance the detection of point WO 2013/123031 PCT/US2013/025913 3 mutations-which is an improvement of the allele specific amplification technique reported by Wu et al. in "Allele-specific enzymatic amplification of f8 globin genomic DNA for diagnosis of sickle cell anemia", Proc. NatI. Acad. Sci. USA 86:2757-60 (1989). In the Morlan technique a mutant specific primer is used 5 together with a center-blocker oligonucleotide. By center-blocker oligonucleotide is meant an oligonucleotide with a mismatch that is about equidistant from either end. The mutant specific primer is entirely complementary to the mutant sequence. The mutant specific primer of Morlan is further trimmed at its 5' end to reduce its melting temperature to about 10 0 C 10 below the anneal/extend temperature used in the PCR. The center blocker oligonucleotide is complementary to the wild type sequence and spans the site of a point mutation so that the point mutation is about equally spanned by it. The center blocker oligonucleotide is further phosphorylated at its 3' end to prevent extension during a PCR reaction. 15 Other example efforts include Dames et al. "Characterization of Aberrant Melting Peaks in Unlabeled Probe Assays", Journal of Molecular Diagnostics, Vol. 9, No. 3, July 2007; and Willem Maat and Pieter A. Van der Velden, "Pyrophosphorolysis Detects B-RAF Mutations in Primary Uveal Melanoma", Investigative Ophthalmology & Visual Science, Jan 2008, Vol. 49, No. 1. 20 With the center-blocker oligonucleotide technique, despite good results with detection of selected point mutations, and significant improvements over prior efforts, it remains a challenge to routinely achieve sensitivities of better than 1% to really utilize the technique to the fullest extent to detect rare mutations. Further, the technique is limited to the detection of point mutations. 25 Sensitive detection of rare alleles that are not solely defined by point mutations continues to be an additional challenge.
WO 2013/123031 PCT/US2013/025913 4 SUMMARY Disclosed is a novel edge-blocker oligonucleotide based Non-Extendable Primer Blocker Allele Specific-Real Time Polymerase Chain Reaction ("AS-NEPB 5 PCR") based mutation assay methodology that overcomes the limitations of prior art approaches to enable amplification and detection of nucleic acid variants present at a frequency lower than 1% to achieve selectivity for targets present at levels of less than 1%. The disclosed method enables a universal design of Allele Specific primer and primer blocker that can be used in any of AS-RT-PCR assays 10 to detect SNP or genetic mutations. The method simplifies assay optimization procedures and achieved 0.1% detection sensitivity with close to 100% specificity. The disclosed edge-blocker oligonucleotide based AS-NEPB-PCR method amplifies allele specific DNA (or RNA) while dramatically blocking amplification of 15 wild type (WT) DNA (or RNA). The disclosed AS-NEPB-PCR design allows ready modification of an existing PCR reaction setup by introducing an edge-blocker oligonucleotide together with an allele specific primer complementary to the mutant sequence to achieve allele specific amplification. In a preferred embodiment the edge-blocker oligonucleotide and allele specific primer may 20 have the same length and differ only at the 3'end where the edge-blocker oligonucleotide has a non-complementary base relative to the mutant sequence and a blocked 3'end while the allele specific primer is preferably entirely complementary to the mutant sequence of interest and has a hydroxyl group at its 3' end to allow extension during a PCR reaction. This method is not only 25 simpler to implement but also successful in routinely suppressing the amplification of the wild type sequence to almost undetectable levels even when the mutant sequence is present at a frequency of about 0.1% of the wild type sequence. Further, the edge-blocker oligonucleotide based AS-NEPB-PCR method is not limited to just detecting point mutations, but can detect specified 30 insertions or deletions as well. The edge-blocker oligonucleotide based AS-NEPB-PCR method was used to detect three different genetic mutations in cancers. The genetic mutations targeted here were in KRAS, BRAF, and EGFR genes, which were detected with the use of three different types of modified edge-blocker oligonucleotides 35 (phosphate, inverted dT and amino-C7). The resulting data were compared to one of the known common blocking methods as a reference. The novel method disclosed herein was able to detect one copy of mutant DNA in 1000-copy of WO 2013/123031 PCT/US2013/025913 5 normal DNA background of a heterogeneous sample, and was far more sensitive than the reference blocking method. A preferred method for detecting a mutant nucleic acid sequence, defined by one or more mutations due to at least one or more of a substitution, 5 a deletion or an insertion, while suppressing the signal due to the wild type sequence includes several steps. Preferably a primer complementary to the mutant nucleic acid sequence is selected such that its 3' end matches up with at least one mutated nucleic acid position. A second primer, an edge-blocker wild type oligonucleotide, is also used. The edge-blocker wild type oligonucleotide 10 corresponds to the wild type sequence such that the 3' end of the edge-blocker wild type primer has at least one mismatch at or about its 3' end relative to the mutant nucleic acid sequence but has no mismatches relative to the wild type sequence. Further, the 3' hydroxyl group at end of the edge-blocker wild type primer is blocked whereby making it non-extendable in a polymerase chain 15 reaction. In a preferred embodiment reverse primers are selected as usual although it should be noted that when trying to detect deletions or insertions, it may be advantageous to use reverse primers similar to the one corresponding to the wild type sequence having a blocked 3' end. The amplification products of a PCR reaction are detected with at least one probe specific for the amplified 20 product in a polymerase chain reaction. Preferably, the polymerase chain reaction is a real-time polymerase chain reaction. In a variation, one or more probes may be added after the polymerase chain reaction is initiated. Further, the initial starting materials may be generated using a reverse transcriptase to investigate transcription products for 25 point or other mutations of interest. An interesting situation handled by this method with ease is when two point mutations of interest are close to each other including being adjacent. In such a situation this method can use the 3' end of the edge-blocker wild type oligonucleotide with at least one mismatch at or about its 3' end relative to the 30 mutant nucleic acid sequence-even two mismatches to cover both the point mutations to even more effectively suppress the amplification of the wild type sequence. It is preferred that the allele specific primer cover both the mutant positions. With such coverage even if there is extension based on the binding of the allele specific primer, the amplification products will correspond to the 35 target mutations rather than the wild type sequence. In an embodiment, as many as two out of the three base pairs immediately adjacent to the blocked 3' end of the edge-blocker wild type oligonucleotide may have a mismatch, but may be counterbalanced by WO 2013/123031 PCT/US2013/025913 6 increasing the length of the edge-blocker wild type oligonucleotide to suppress amplification of the wild type sequence by the allele specific primer. In a preferred embodiment, the edge-blocker wild type oligonucleotide is equal in length to the allele specific primer with both having 3' ends that cover 5 similar portions of the mutant or wild type sequence. The method can detect a mutant sequence even when it is present at a level of only about 1 in 1000 or even rarer. However, as noted the edge-blocker wild type oligonucleotide may be longer at its 5' end than the allele specific primer to assist it in competing out the 10 allele specific primer to prevent accidental extension of the wild-type sequence by the allele specific primer. To ensure effective competition by the edge-blocker wild type oligonucleotide the melting temperature of the allele specific primer is lower than that for the edge-blocker wild type oligonucleotide relative to the wild type 15 sequence. Preferably, the melting temperature of the allele specific primer is lower, e.g., about 10 0 C lower, than that for the edge-blocker wild type oligonucleotide. Effective competition by the edge-blocker wild type oligonucleotide for the wild type sequence is helped by ensuring that the edge-blocker wild type 20 oligonucleotide is present at a concentration suitable for suppression of the wild type sequence while allowing amplification of the mutant sequence. Preferably, this concentration is comparable-while being at least equal-to the level of the wild type sequence concentration. The concentration of the allele specific primer, on the other hand, is in excess of that of the wild type sequence since it 25 is incorporated into the PCR product while the edge-blocker wild type oligonucleotide serves to suppress amplification of the wild-type sequence, the likelihood of which decreases as the allele specific primer levels decrease with amplification of the target PCR product. Thus, preferably, the concentrations of the edge-blocker wild type oligonucleotide and the allele specific primer are 30 comparable. Preferably, using, for instance calibration curves, the disclosed method for the detection of rare mutant nucleic acid sequence includes quantitation to estimate a level of the mutant nucleic acid sequence relative to the wild type sequence. Such a calibration curve may be generated by spiking the samples for 35 a polymerase chain reaction. Early detection of cancer to better provide therapeutic intervention is made possible when the disclosed method is used to detect tumor cells by the mutant nucleic acid sequence corresponding to a tumor cell type in a tissue, WO 2013/123031 PCT/US2013/025913 7 CTCs or other sample collected from a patient. If the rare target allele corresponds to metastatic cell disease, intervention before the tumor cells become noticeable becomes a more realistic possibility. Thus, the disclosed method is a diagnostic method suitable for early 5 detection of cancer by way of detecting the presence of one or more target cells in a sample derived from a patient, which cells harbor a mutant nucleic acid sequence, and the presence of which cells likely leads to malignancy or recurrence. The method comprises selecting an allele specific primer corresponding to a portion of the mutant nucleic acid sequence such that the 3' 10 end of the allele specific primer does not have a mismatch while being aligned with at least one mutated nucleic acid position in a target. Also used is an edge blocker wild type oligonucleotide corresponding to the wild type sequence such that the 3' end of the edge-blocker wild type oligonucleotide has at least one mismatch at or about its 3' end, and, wherein, furthermore, the 3' end of the 15 edge-blocker wild type oligonucleotide is blocked whereby making it non extendable competitive inhibitor in a polymerase chain reaction. Together with other ingredients and one or more probes to detect the desired amplification products, a polymerase chain reaction, preferably a real time polymerase chain reaction is carried out. The method not only detects cancer usefully early, but 20 also can guide one to therapies best suited for treating the patient. As a check on spurious signals, the mutant nucleic acid sequence is detected by detecting the reaction products less than a pre-specified number of amplification cycles. As a further safeguard against spurious signals, mutant nucleic acid 25 sequence's presence is detected if amplification products corresponding to it are detected but a reference sequence, treated like the mutant sequence is not detected in the same sample. The target sequence, with or without its corresponding wild-type like sequence, may be used to spike the sample. This can determine sensitivity and other parameters of interest. 30 The edge-blocker wild type oligonucleotide is blocked by derivatizing or replacing its 3' hydroxyl group with one or more selected from the group consisting of phosphate, inverted dT and amino-C7. These and other benefits of the disclosed novel AS-NEPB-PCR method and variations thereof are described next with the aid of the included Figures. 35 WO 2013/123031 PCT/US2013/025913 8 BRIEF DESCRIPTION OF THE FIGURES Figure 1. General diagram for edge-blocker oligonucleotide based AS-NEPB-PCR design: Primer with 3' end modification (phosphate or inverted dT) functions as a blocking group to prevent polymerase extension on wild type sequence. - PCR 5 amplifies only AS primed mutation while WT strain is blocked by a modified non extendable primer (edge-blocker oligonucleotide based AS-NEPB-PCR). Figure 2. Mapping of edge-blocker oligonucleotide designs for V600E. AS Primer 1 and 2 indicate BRAF-AS-Forward Primer-1 and 2 (AS Primer-1 is 6 bases longer 10 than AS Primer-2 at 5') corresponding to Seq. Id. 1 and Seq. Id. 2 respectively. Edge-blocker oligonucleotide based AS-NEPB-PCR: WT-1 and 2 stand for edge blocker oligonucleotide-1 and edge-blocker oligonucleotide-2 and they correspond to Seq Id. 5 and Seq. Id. 6 respectively. Probe-dye (Dye labeled probe-Seq. Id. 4) and reverse primer (Seq. Id. 3) are common for both assays. 15 AS primer-1, Seq. Id. 1, runs with edge-blocker oligonucleotide-WT-1 (NEPB-WT 1), Seq. Id. 5, and AS primer-2, Seq. Id. 2, with edge-blocker oligonucleotide-WT 2 (NEPB-WT-2), Seq. Id. 6. Bold letters in legends and in the figures represent positions for mismatch, such as 'A- BRAF mutation (V600E; T>A)' in AS Primer 1 and 2; '*' represents 3' modifications here and in the figures. 20 Figure 3. Mapping of edge-blocker oligonucleotide designs for two K-ras gene mutations. AS Primer-KrasP4 (Seq. Id. 17) and KrasP7 (Seq. Id. 21) indicate G12V AS-Forward Primer and G13D-AS-Forward Primer. NEPB-WT-KrasP4B (Seq. Id. 18) and P7B (Seq. Id. 22) stand for G12V-NE edge-blocker oligonucleotide and 25 G13D-NE edge-blocker oligonucleotide. KProbel (Seq. Id. 20) and KProbe2 (Seq. Id. 24) are Dye labeled piobes, and reverse primer is common for both assays. AS Primer-KrasP4 (Seq. Id. 17) runs with edge-blocker oligonucleotide-WT-KrasP4B (Seq. Id. 18) and KProbel (Seq. Id. 20). AS Primer-KrasP7 (Seq. Id. 21) runs with center-blocker oligonucleotide-WT-KrasP7B (Seq. Id. 22) and KProbe2 (Seq. Id. 30 24). Red "t" indicated K-ras p.G12V; mutation (c.G>T) and Red "a" indicated K-ras p.G13D; mutation (c.G>A) in AS Primer-KrasP4 and P7 and as usual '*' represents -3' modifications. Figure 4. BRAF V600E mutant detection: 8 out of 20ul PCR products from the 35 20ng DNA reaction were loaded on the gel. The single sharp bands were observed from 5% to 0.1% mutant reactions and no PCR products were observed from SKBR3 WT AS-NEPB2-PCR-2 reaction, except Actin-PCR products.
WO 2013/123031 PCT/US2013/025913 9 5 Figure 5a. KrasP4 (G12V; G>T) NEPB or CBO blocker PCR on SW480 Cell line DNA: 8 out of 20ul PCR products from the 20ng DNA reaction were loaded on the gel. Clean PCR products were visualized on a 4% agarose gel from 0.1% mutant 10 reactions and no PCR products were observed from WT reaction, except Actin PCR products. The PCR product was also visualized from WT amplification without adding any Blockers. All of NTC was not undetermined. Figure 5b. KrasP7 (G13D; 13G>A) NEPB or CBO blocker PCR on HCT116 Cell line 15 DNA: 8ul PCR products were loaded on the gel. Clean PCR products were visualized from 0.1% mutant reactions and no PCR products were observed from WT reaction. The PCR product was visualized as well from WT amplification without adding any Blockers. 20 Figure 6. EGFR Exon 21 L858R (2573 T>G) AS-NEPB-PCR on NCI-H1975 Cell line DNA: 8ul PCR products were loaded on the gel. Clean PCR products were visualized from 0.1% mutant reactions and no PCR products were observed from WT reaction. The PCR product was visualized as well from WT amplification without adding any Blockers. 25 WO 2013/123031 PCT/US2013/025913 10 DETAILED DESCRIPTION With the aid of examples and exemplary discussions, disclosed herein is a novel edge-blocker oligonucleotide based Non-Extendable Primer Blocker Allele Specific-Real Time Polymerase Chain Reaction ("AS-NEPB-PCR") based mutation 5 assay methodology that overcomes the limitations of prior art approaches to enable amplification and detection of nucleic acid variants present at a frequency lower than 1% to achieve selectivity for targets present at levels of less than 1%. The disclosed method enables a universal design of Allele Specific primer and primer blocker that can be used in any of AS-RT-PCR assays to detect 10 SNP or genetic mutations. The method simplifies assay optimization procedures and achieved 0.1% detection sensitivity with close to 100% specificity. The description starts with a detailed outline of experiments demonstrating the effectiveness of the technique. 15 Materials and Methods Cell Line and FFPE Tissue Samples Cancer cell lines were ordered from American Type Culture Collection (ATCC, Manassas, VA. US) and cultured according ATCC protocols. The following 20 cell lines containing specific allele sequences were used in this study: HT29 cell line (ATCC# HTB-38D) is heterozygous and SK-MEL28 cell line (ATCC# CRL-5908) is homozygous in BRAF mutation with predicted mutation effect of p.V600E (c.1799T>A). Characterization of BRAF mutation was described as likely oncogenic mutation (11). HCT 116 cell line (ATCC# CCL-247) has a mutation in 25 codon 13 (p.G13D; c.G>A) and SW480 cell line (ATCC# CCL-228) has a mutation in codon 12 (p.G12V; c.G>T) of K-ras protooncogene. NCI-H1975 cell line (ATCC# CRL-5908) carries EGFR Exon 21 recurrent heterozygous missense mutation of L858R-2573T>G (12). SKBR3 cell line (ATCC# HTB-30) was used as wild type control for BRAF, K-ras and NCI-H358 cell line (ATCC# CRL-5807) as wild type 30 control for EGFR mutation detection assays. Melanoma and Colon tissue samples were purchased from ProteoGenex (Culver City, CA. US), one of the providers of biological specimens. Patient Samples 35 From 42 patients with metastatic colorectal cancer, 2 x 30 mL blood samples were taken for circulating tumor cells (CTC) enumeration and characterization by way of vena puncture before liver metastasis resection and prior to tumor manipulation. CTC enrichment and enumeration were processed WO 2013/123031 PCT/US2013/025913 11 by CellSearch system (Veridex LLC, Raritan, NJ). All patients were included in the Erasmus Medical Center, Rotterdam, Netherlands after written informed consent was obtained. 5 DNA extraction Cell line DNA was extracted by using AllPrep TM DNA/RNA Micro Kit and FFPE tissue DNA was extracted by using RNeasy FFPE kit from Qiagen (Valencia CA. US Cat# 80284 and 74404) according to the manufacturer's instructions. Then, extracted DNA was quantified on Nanodrop-2000 Spectrophotometer 10 (Thermo Fisher Scientific, Wilmington, DE. US) following the User Manual and stored at -20*C until later use. Oligo Design A general diagram for NEPB is demonstrated in Figure 1. For an allele that 15 was analyzed, allele-specific primers (ASP) can be designed to either positive or negative DNA (or RNA) strand. Either for the forward or the reverse primer, 3' end is anchored on the variant base. The melting temperatures (Tm) of ASP should be close to the PCR extension temperature. Edge-blocker oligonucleotide based AS-NEPB-PCR method was designed 20 to the same strand and length as the allele-specific primer except the forward or reverse primer 3'-end is anchored on the WT base and not extendable by polymerases with 3' end modification (phosphate or inverted dT or amino-C7). Center-blocker oligonucleotide design was based on the criteria listed in the paper (7) and used for comparison to edge-blocker oligonucleotide based AS 25 NEPB-PCR method. The design sequences were assembled by SeqMan II expert sequence analysis software (DNASTAR Inc, WI, US); Figure 2 for the design of BRAF gene and Figure 3 for two K-ras genes. All of the designs including non-AS forward or reverse primers and probe used Oligo Primer Analysis Software from Molecular Biology Insights (Cascade, 30 CO. US). Tm was calculated by Oligo software based on PCR condition of 0.2uM primers, 100mM [Monovalent Cation] and 3mM free Mg [2+]. All of the oligonucleotides, including primers, probe and blocker, were purchased from Biosearch Technologies, Inc (Novato, CA. US), except MGB probes. Modified oligonucleotides including Fluorophore dye (FAM and CAL 35 Fluor Orange) labeled at 5' ends and BHQ or Phosphate at 3 'ends (Table la, b and C) were synthesized according to the manufacturer's instructions. Two MGB probes for K-ras assay were purchased from Applied Biosystems (Foster City, CA).
WO 2013/123031 PCT/US2013/025913 12 AS-NEPB- PCR Amplification The AS-NEPB-PCR assay for allele analysis of B-Raf, K-ras and EGFR included one ASP on the positive strand, one NEPB, one fluorescence labeled sequence specific TaqMan probe with BHQ or MGB at 3'end and one non-AS 5 reverse primer (RP) on the negative strand. The sequences of primers, probe and oligonucleotide blockers are listed in Tablela, Taleib and Table 1c below for the BRAF gene, Kras gene and EGFR gene respectively. All Tables are provided in the section titled 'Tables', which follows the 'References' section. The assay was run as singlex or duplex AS- RT-PCR format, AS gene with 10 Internal Control gene in two individual reactions or in one reaction, on Applied Biosystems 7500 (or 7900) Real-Time PCR System (Foster City, CA). For BRAF p.V600E (c.1799T>A) detection, the final concentrations of each primer, blocker and probe of AS-NEPB-PCR assay are listed in Tables 2a. The assay was set up as follows: lOng to 50ng of DNA heterogeneous mixture was 15 used and was carried out in a final volume of 20 ul in reaction. The AS-NEPB-PCR was carried out using TaqMan* Gene Expression Master Kit (Applied Biosystems, Part # 4368814). Each reaction consisted of 10.0 ul of 2X PCR Master Mix, 1 ul of 20x primer/blocker/probe mix, and 1-5 ul of 10 ng /ul total DNA sample. The AS NEPB-PCR assays were run as follows: 1 cycle of denaturation at 95 *C for 10 min, 20 40 cycles of 95 *C for 20 seconds denaturation and 64*C in favor of BRAF-NEPB1 PCR-1 or 58 *C in favor of BRAF-NEPB2-PCR-2 for 45 seconds annealing and extension under run Standard Mode. To compare with the center-blocker oligonucleotide based AS-NEPB-PCR method, two BRAF center-blocker oligonucleotides (Tablela) designed based on 25 the criteria listed in the publication (7) were tested. The final concentrations of center-blocker oligonucleotides were tested with 1x, 2x of the AS primer concentrations. The AS primer concentrations are 0.9um with 0.9um of reverse primers and 0.2um of probe in a final 20ul reaction. The PCR reagents and conditions are the same as the BRAF-NEPB1-PCR-1 assay. The concentrations of 30 each primer, blocker and probe are listed in Table 2a. For two K-ras mutations, the final concentrations of each primer, blocker oligonucleotides and probes of AS-NEPB-PCR assay are listed in Tables lb and 2b. The assay was set up as follows: 20ng of DNA heterogeneous mixture was used and was carried out in a final volume of 20 ul in reaction. The AS-NEPB-PCR was 35 carried out using TaqMan* Gene Expression Master Kit. Each reaction consisted of 10.0 ul of 2X PCR Master Mix, 2 ul of 10x primer/blocker/probe mix, and 2 ul of 10 ng /ul total DNA sample. The AS-NEPB-PCR assays were run as follows: 1 cycle of denaturation at 95 *C for 10 min, 40 cycles of 95 *C for 20 seconds WO 2013/123031 PCT/US2013/025913 13 denaturation and 60*C for 45 seconds annealing and extension under run Standard Mode. The center-blocker oligonucleotide based AS -PCR method for K-ras was run at the same PCR condition as the edge-blocker oligonucleotide based AS 5 NEPB-PCR method except for using 4x center-blocker oligonucleotide concentration as corresponding ASP concentration, which was suggested in the publication (7). For EGFR mutation, the final concentrations of each primer, blocker oligonucleotides and probes of AS-NEPB-PCR assay are listed in Tables 1c and 2c. 10 The assay set-up was the same as K-ras mutation assay except DNA template. DNA samples were from NCI-H1975 and NCI-H358 heterogeneous mixture. The AS-NEPB-PCR assays were run as follows: 1 cycle of denaturation at 95 *C for 10 min, 40 cycles of 95 *C for 20 seconds denaturation and 63*C for 45 seconds annealing and extension under run Standard Mode. 15 Data Analysis Edge-blocker oligonucleotide based AS-NEPB-PCR detection sensitivity/specificity of BRAF (V600E) and K-ras (G12V or G13D) were estimated by using dilutions of the related mutant cell line DNA (describe the above Cell 20 Line Sample section) in wild-type DNA of the cell lines SKBR3. Dilutions were made at 5%, 1%, 0.5% and 0.1% mutant DNA and data were collected and analyzed by ABI 7500 fast System SDS software (Applied Biosystems). The same analysis method was used for both center-blocker oligonucleotide based AS NEPB-PCR and edge-blocker oligonucleotide based AS-NEPB-PCR methods. Data 25 was analyzed by manual threshold of 0.1 and baseline from 5 to 15 to obtain CT value for both FAM and VIC channels. Assay was considered valid when Actin CT value was less than or equal to 27, specific mutant gene CT was less than or equal to 37 (~3 copies) and all No Template Control (NTC) had undetectable CT. PCR aliquots were also analyzed by agrose gel electrophoresis with 100 bases 30 molecular marker (Invitrogen, Carlsbad, CA). One specific PCR product from a corresponding positive sample should be present after amplification. Sequence Analysis 35 Mutations detected by AS-NEPB-PCR in BRAF V600E were confirmed by direct sequencing using Rhodamine dye terminator cycle sequencing kit (Big Dye; Applied Biosystems). Cell line (20ng) and FFPE (50ng). DNA samples containing mutations were amplified by non-AS-PCR using sequence primers (Tablela) WO 2013/123031 PCT/US2013/025913 14 under the same PCR condition as AS-NEPB2-PCR-2. To verify the sequences, PCR amplified products were sent to GENEWIZ (South Plainfield, NJ, US). Sequencing was done on ABI 3730xl DNA Analyzer and analyzed using ABI PRISM DNA Sequencing Analysis Software (Applied Biosystems) according to the 5 manufacturer's instructions. Results and Discussions For BRAF V600E gene mutation detection, center-blocker Oligo (CBO) method was first adapted from the publication of K-ras mutation detection (7), 10 the ASP and blocker designs were followed the criteria listed in the paper. Several assay conditions were tested in order to reach 0.1% detection sensitivity of BRAF mutation gene. We have tried to optimize assay conditions by titrated various annealing temperature (58, 60, 62, 64 and 65 0 C) and ratio of ASP: PB (1:4, 1:2 and 1:1). However, none of conditions could reach 0.1% mutant 15 detection sensitivity and without non- specific amplification on WT template. The results were observed under one of conditions for each CBO; 0.5% detection sensitivity was obtained without non- specific amplification from CBO-1 (64 0 C and 1:1 ratio), however, the CT in 0.5% has been shown great than 36. CBO-2 gave constantly non-specific amplification (64 0 C and 1:2 ratio) if having 0.1% 20 detection sensitivity (Table 3). Under other conditions, AS-PCR reaction was blocked by increased concentration of the blocker or annealing temperature; and more non-specific amplification occurred when reducing the concentration of the blocker or annealing temperature (data not showed). In addition, CBO method required 25 that the sequences of Primer, Blocker and Probe have to be partial-overlapping, blocker discriminating base in the middle of the oligonucleotide and different Tm (length), which bring about challenges for BRAF gene Oligo selection and assay condition optimization although the method was successful in the K-ras mutation assay. 30 Edge-blocker oligonucleotide (EBO) based AS-NEPB-PCR method was developed to improve detection sensitivity and remove non-specific amplification for BRAF gene mutation detection assay. Two sets of EBO, EBO-1 and EBO-2, with the corresponding forward AS primers, BRAF-AS-Forward Primer-1 and-2, were designed and evaluated with the BRAF V600E allelic 35 variant. A common reverse primer and probe were designed downstream of the polymorphic site and used in AS-NEPB-PCR. A few of assay conditions were needed to be tested due to the same Tm for both ASP and NEPB; annealing temperature (64 and 65 0 C) and ratio of ASP: EBO (1:1 or 1:2) for NE primer WO 2013/123031 PCT/US2013/025913 15 blocker-1 and annealing temperature (56, 58 and 60 0 C) and ratio of ASP: EBO (7:1 or 3:1) for NE primer blocker-2. The annealing temperature screening was selected to be close to Tm of ASP (Table la). The ratio of ASP: EBO screening was decided based on the data generated from AS-PCR without adding up edge 5 blocker oligonucleotide (Table 3). BRAF-AS-Forward Primer-2 without edge blocker oligonucleotide gave non-specific amplification when WT DNA was greater 50ng input (data not shown), so less EBO was needed. The results demonstrated that incorporation of edge-blocker oligonucleotide based AS-NEPB-PCR enhanced the sensitivity of the AS-PCR, 10 without non-specific amplification on WT DNA. It performed better than CBO method (Table 3). Edge-blocker oligonucleotide based AS-NEPB-PCR method also showed strong allele specific amplifications, detected one copy of mutant DNA in 1000-copy normal DNA background of heterogeneous mixture (0.1% mutation frequency and 2-3 mutant copies) in both AS-NEPB-PCR assays. BRAF-AS 15 Forward Primer-2 with EBO-2 (AS-NEPB2-PCR-2) gave the best result to discriminate the wild type and mutant alleles, in which delta CT is calculated as the difference between SKBR3 WT cell line CT and the HT29 mutant/SKBR3 WT mixtures cell line CT. Repeatable 0.1% mutant detection sensitivity (down to 3-5 copies of mutant) and undetectable WT specificity (up to 50ng WT cell line DNA) 20 were obtained by using AS-NEPB2-PCR-2 (Table 4). Undetectable WT specificity was also observed with 175ng WT tissue DNA (data not shown). On gel image, single sharp bands were observed from 5% to 0.1% mutant reactions and no PCR products were observed from SKBR3 WT AS-NEPB2-PCR-2 reaction, except Actin PCR products (Figure 4). 25 Direct sequencing, as the gold standard, was used to verify the AS NEPB2-PCR-2 method in both cell line and FFPE tissue DNA samples. The 100% sensitivity and specificity was obtained by using AS-NEPB-PCR method based on the sequence data (Table 5). The edge-blocker oligonucleotide based AS-NEPB-PCR method was also 30 verified on two KRAS gene mutants (p.G12V; G>T and p.G13D; 13G>A) and compared to the center-blocker oligonucleotide based AS-PCR method. A small number of ASP vs. edge-blocker oligonucleotide ratios were tested to obtain the best concentration of edge-blocker oligonucleotides. The same AS primers described in the paper were used under the annealing temperature 60 0 C 35 suggested by the paper (7). The best result was observed with 1:1 ratio of ASP to edge-blocker oligonucleotide for both Kras G12V and G13D mutant gene detection assays; 0.1% detection sensitivity (~5 copies) without non-specific amplification on WT DNA (Tables 6a, 6b, and 6c). We have tested the edge- WO 2013/123031 PCT/US2013/025913 16 blocker oligonucleotide based AS-NEPB-PCR and center-blocker oligonucleotide based AS- PCR methods under the same reaction condition. Equivalent assay performances were obtained (Table 7 and Figures 5a and 5b). Good assay precision was obtained from the edge-blocker oligonucleotide based AS-NEPB 5 PCR method with <3% CV in three individual runs for two K-ras 0.1% (~5 copies) mutants. Edge-blocker oligonucleotides modified by inverted dT or amino-C7 were also evaluated. The equivalent assay performances were obtained as 3' end modified by Phosphate (Table 8). 10 We have tested edge-blocker oligonucleotide based AS-NEPB-PCR method on 42 clinical samples, circulating colorectal tumor cells. BRAF (V600E) mutations were detected in two tissue samples and one CTC sample, which were matched with the sequencing data. Non-specific amplification was not observed in both tissue and CTC samples which confirmed by sequencing data (Table 9). 15 Edge-blocker oligonucleotide based AS-NEPB-PCR method was also evaluated on EGFR gene (exon 21_L858R) mutation detection. The results showed 0.1% of mutations (~5 copies) were detected without non-specific amplification at 1:1 ratio of ASP to edge-blocker oligonucleotide and Annealing Temp 63 0 C (Table 10 and Figure 6). Good assay precision, <2% CV, was obtained 20 from 5%, 1% and 0.1% in the triplicates. Edge-blocker oligonucleotide based AS-NEPB-PCR method has been employed on the detection of 3 different genes (B-Raf, K-Ras, and EGFR) and 4 mutants (V600E, G12V, G13D and L858R) effectively. Optimal assay conditions were determined easily for each of the assays due to the advantage of edge 25 blocker oligonucleotide design, which has the same strand and length as the allele-specific primer producing almost the same melting temperatures (Tm) as ASP. We found that (1) normally 2 annealing temperatures are only needed beside Tm, one degree below and one degree up of ASP's Tm and (2) 1:1 ratio of ASP : blocker is suitable for most cases to get an optimal assay condition. 30 In conclusion, edge-blocker oligonucleotide based AS-NEPB-PCR method is a highly sensitive and specific method for mutation detection in highly heterogeneous samples. Also, the edge-blocker oligonucleotide based AS-NEPB PCR method provides great advantages in simplifying assay design and assay optimization over the other blocking method. Edge-blocker oligonucleotide 35 based AS-NEPB-PCR method allows an efficient workflow when a number of different mutation assays need to be developed.
WO 2013/123031 PCT/US2013/025913 17 REFERENCES 1. Guttmacher, A.E. and F.S. Collins. 2002. Genomic medicine-a primer. N. Engl. J. Med.347:1512-1520. 5 2. Phillips, K.A., D.L. Veenstra, E. Oren, J.K. Lee, and W. Sadee. 2001. Potential role of pharmacogenomics in reducing adverse drug reactions: a systematic review. JAMA 286: 2270-2279. 3. Newton, C.R., A. Graham, L.E. Heptinstall,S.J. Powell, C. Summers, N. Kalsheker, J.C.Smith, and A.F. Markham. 1989. Analysis of any point mutation 10 in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 17:2503-2516. 4. Livak, K.J., S.J.A. Flood, and J.A. Todd. 1995. Towards fully automated genome-wide polymorphism screening. Nat. Genet. 9:341-342. 5. Shale Dames and Karl V. Voelkerding at el, Characterization of Aberrant 15 Melting Peaks in Unlabeled Probe Assays , Journal of Molecular Diagnostics, Vol. 9, No. 3, July 2007 6. Willem Maat and Pieter A. Van der Velden, Pyrophosphorolysis Detects B RAF Mutations in Primary Uveal Melanoma, Investigative Ophthalmology & Visual Science, Jan 2008, Vol. 49, No. 1 20 7. Morlan J, Baker J, Sinicropi D, Mutation Detection by Real-Time PCR: A Simple, Robust and Highly Selective Method. PLoS ONE 4(2): e4584. doi:10.1371/journal.pone.0004584(2009) 8. Methods, Compositions, and Kits for Detecting Allelic Variants, Patent by life technologies corporation, International Application No.: 25 PCT/US2010/028963 9. Susana Benlloch, et al. Detection of BRAF V600E Mutation in Colorectal Cancer. JMD November 2006, Vol. 8, No. 5 10. Tomoaki Tanaka at el, Frequency of and variables associated with the EGFR mutation and its subtypes. Int. J. Cancer: 126, 651-655 (2010) VC 2009 30 11. Ikediobi, O.N et al. Mutation Analysis of 24 Known Cancer Genes in the NCI 60 Cell Line Set Mol. Cancer Ther., 5(11):2606-2612, (2006) 12. Raffaella Sordella at el, Gefitinib-Sensitizing EGFR Mutations in Lung Cancer Activate Anti-Apoptotic Pathways. Science 305, 1163 (2004) 35 WO 2013/123031 PCT/US2013/025913 18 TABLES Table la: Primer/Probe/blocker Sequences and Labeling for BRAF gene: for probes 5' Modification of FAM and CAL Fluor orange 560 and 3' Modification of 5 BHQ; blockers have 3' end phosphate modification. Se, BRAF Sequence (53" Seq. V600E Nuence Sequence (5'-3") Assay BRAF-AS-
BRAF
1 Forward 268DF-AS AGGTGATTTTGGTCTAGCTACAGA 68.2 Primer-1 BRAF-AS- BRAF 2 Forward 274DF-S TTTTGGTCTAGCTACAGA 58.1 Primer-2 Common
BRAF
3 Reverse 347SR AGCCTCAATTCTTACCATCCA 71.5 Primer Common BRAF-
FAM
4 Pmon BRAFP AGTGGGTCCCATCAGTTTGAACAGT 79.0 -BHQ EBO NE BRAF- AGGTGATTTTGGTCTAGCTACAGT 5 blocer-I 268DF-WTB P04 68.2 EBO NE BRAF 6 Primer 274DF-TB TTTTGGTCTAGCTACAGTPO4 58.1 blocker-2 7 CBO BRAF- TCTAGCTACAGTGAAATCTCGATGG 83.4 blocker-1 280ASB32 AGTGGGT-P0 4 CBO BRAF- TCTAGCTACAGTGAAATCTCGAT 8 blocker-2 280ASB23 P468.3 9 329520 AAGCCACCCCACTTCTCTCT 71.6 10 Actin B-actin AATGCTATCACCTCCCCTGT 71.4 (Internal 33461-20 Control) B-actin Orange 11 3319P26 AGAATGGCCCAGTCCTCTCCCAAG 84.0 TC-BHQ 12 BRAl- BRAF- TGATAGGAAAATGAGATCTACTGT 66.9 Primer BRAF- TTTACATAAAAAATAAGAACACTGAT 67.0 13 (Nest- 472DR T 6. PCR) 14 Sequence BRAF- GTGATTTTGGTCTAGCTA 58.5 PCR 270DF 15 Primer 3BRAF AGCCTCAATTCTTACCATCCA 71.5 16 SPqience BRAF CTCAATTCTTACCATCCACAAA 69.6 WO 2013/123031 PCT/US2013/025913 19 Table 1b: Primer/Probe/blocker Sequences and Labeling for K-ras gene: for 5 probes 5' Modification of FAM and 3' Modification of MGB; blockers have 3' end phosphate modification. Actin primers and probe are the same as BRAF assay in Table la. The melting temperatures (Tm) were calculated by Oligo software as described in "Oligo Design" for Tables la, lb and 1c. Seq ID K-ras Mutation Assay Sequence Name Sequence (5'-3") Tm [ 0 C] 17 G12V-AS Forward Primer KrasP4 TTGTGGTAGTTGGAGCTGT 66.3 18 G12V-EBO NE Primer blocker KrasP4B TTGTGGTAGTTGGAGCTGG-P04 -66.3 19 G12V-CBO blocker ASB1 TTGGAGCTGGTGGCGTAGG-P04 77.9 20 G12V-Probe KProbel FAM-CACTCTTGCCTACGC-MGB 65.9 21 G13D-AS Forward Primer KrasP7 GTAGTTGGAGCTGGTGA 60.2 22 G13D-EBO NE Primer blocker KrasP7B GTAGTTGGAGCTGGTGG-P04 -60.2 23 G13D-CBO blocker ASB2 GCTGGTGGCGTAGGC-P04 74.8 24 G13D-Probe KProbe2 FAM-CACTCTTGCCTACG-MGB 59.9 25 Common Reverse Primer KrasR TGATTCTGAATTAGCTGTATCGTCAA 74.3 10 Table 1C: Primer/Probe/blocker Sequences and Labeling for EGFR gene (L858R; 2573 T>G): 5' Modification of FAM and 3' Modification of BHQ for probes; 3' end phosphate modification for blockers. Actin primer/probe are the same as BRAF 15 assay in Table la. Seq ID EGFR Mutation Assay Sequence Name Sequence (5'-3") Tm( 0 C) 26 Ex2l-248FAS ATCACAGATTTTGGGCG 64.3 27 Ex21-248FWTB ATCACAGATTTTGGGCT-P04 -63.0 Ex2lL858R 28 Ex21-330SR GAAAATGCTGGCTGACCTAAA 72.5 29 Ex21-271 P FAM-TGGGTGCGGAAGAGAAAGAATACC-BHQ 79.6 20 WO 2013/123031 PCT/US2013/025913 20 Table 2a: Concentration of primer/blocker/probe in AS-NEPB-PCR BRAF V600E duplex assay BRAF V600E NEPB Assa 6Name(Primer/Blocker/Probe) Final Conc. (uM) Assay BRAF-268DF-AS (SEQ ID 1) 0.450 BRAF-AS-NEPB1-PCR-1 BRAF-347SR (SEQ ID 3) 0.450 BRAF-268DF-WTB (SEQ ID 5) 0.900 BRAF-305DP (SEQ ID 4) 0.250 BRAF-274DF-AS (SEQ ID 2) 0.900 BRAF-AS-NEPB2-PCR-2 BRAF-347SR (SEQ ID 15) 0.900 BRAF-274DF-WTB (SEQ ID 6) 0.125 BRAF-305DP (SEQ ID 4) 0.250 B-actin 3295U20 (SEQ ID 9) 0.030 Actin B-actin 3346L20 (SEQ ID 10) 0.030 B-actin 3319P26_Ora (SEQ ID 0.030 11) 5 Table 2b: Concentration of primer/blocker/probe in AS-NEPB-PCR K-ras singlex assay K-ras Mutation Assay Name(Primer/Blocker/Probe) Final Conc. (uM) KrasP4 (SEQ ID 17) 0.90 G12V-NE Primer Blocker KrasR (SEQ ID 25) 0.90 KrasP4B (SEQ ID 18) 0.90 KProbel (SEQ ID 20) 0.20 KrasP7 (SEQ ID 21) 0.90 G13D-NE Primer Blocker KrasR (SEQ ID 25) 0.90 KrasP7B (SEQ ID 22) 0.90 KProbe2 (SEQ ID 24) 0.20 B-actin 3295U20 (SEQ ID 9) 0.40 Actin B-actin 3346L20 (SEQ ID 10) 0.40 B-actin 3319P26_Ora (SEQ ID 11) 0.20 WO 2013/123031 PCT/US2013/025913 21 Table 2C: Concentration of primer/blocker/probe in AS-NEPB-PCR EGFR singlex assay EGFR Mutation Assay Name(Primer/Blocker/Probe) Final Conc. (uM) Ex21-248FAS (SEQ ID 26) 0.90 Ex21 L858R Ex2l-248FWTB (SEQ ID 27) 0.90 Ex21-330SR (SEQ ID 28) 0.90 Ex21-271P (SEQ ID 29) 0.20 B-actin 3295U20 (SEQ ID 9) 0.40 Actin B-actin 3346L20 (SEQ ID 10) 0.40 B-actin 3319P26_Ora (SEQ ID 11) 0.20 WO 2013/123031 PCT/US2013/025913 22 Table 3: lOng DNA of HT29 mutant/SKBR3 WT mixtures at various ratios were input into the PCR reactions for BRAF V600E mutant detection, 0.1% of mixtures equivalent to ~3 copies of mutant. Undetermined in PCR was considered as CT 40 during delta CT calculations. Both NE Primer blocker, EBO, method reached 5 0.1% detection sensitivity without non-specific amplification. NE Primer blocker 2 showed the best results to discriminate alleles (bigger delta CT between WT and mutant) compared to CBO blocker method. CBO blocker-1 showed 0.5% detection sensitivity and non-specific amplification on WT DNA. However, the delta CT between WT and mutant was ~3Ct less than NEPB method. CBO blocker 10 2 gave constantly non-specific amplification if having 0.1% detection sensitivity. All the final reaction conditions were described in the Method of "AS-NEPB-PCR Amplification". % Mutant/ No NE Primer NE Primer CBO CBO PCR Result blocker blocker-1 blocker-2 blocker-1 blocker-2 5% 28.9 31.2 32.6 33.5 34.2 1% 28.7 31.1 32.3 34.6 39.9 Undetermin 0.5% 29.0 30.9 32.1 34.6 ed Undetermin 0.1% 29.3 31.3 33.3 34.4 ed Mutant Delta No NE Primer NE Primer CBO CBO CT to WT blocker blocker-1 blocker-2 blocker-1 blocker-2 5% 2.9 7.4 8.5 5.5 3.3 19 1.6 3.8 5.9 3.6 3.3 0.5% 0.7 3.6 6.1 2.6 2.2 0.1% 0.5 2.2 3.1 -1.0 1.2 15 WO 2013/123031 PCT/US2013/025913 23 Table 4: 10-50ng DNA of HT29 mutant/SKBR3 WT mixtures at various ratios were input into AS-NEPB2-PCR-2 of BRAF V600E mutant detection. The method detected constantly 0.1% of mutation rate without non-specific amplification. All of Actin CTS were <25 and NTC was not undetermined. 5 %Mutant/PCR Ong 20ng 50ng Result (CT) 5.0% 31.5 28.5 27.5 1.0% 34.1 31.9 30.2 0.5% 33.9 32.1 31.7 0.1% 36.9 33.6 33.6 WT Undetermined Undetermined Undetermined Table 5: The assay gave consistent performance on detecting the mutated allele without non-specific amplification of DNA samples, which were confirmed by 10 sequencing. NVD-No variants detected. Sequence Data (p.V600E Melanoma FFPE BRAF (CT) ACTIN (CT) GTG>GAG) 13820T2 26.6 24.5 1. T>A(50%) 13819T2 25.5 24.1 2. T>A(50%) 13788T2 28.5 24.9 3. T>A(50%) 4. p.V600K c.1798_1799 13724T2 38.6 26.6 4TAA(c.1798x- 179 GT>AA(Complex60%) Colon FFPE 02671T1 Undetermined 22.7 5. NVD 02671T2 Undetermined 24.1 6. NVD 02973T1 Undetermined 24.8 7. NVD 02973T2 Undetermined 25.7 8. NVD Cell Line DNA H29_40% 26.7 24.4 9. T>A(40%) H29_20% N/A N/A 10. T>A(20%) H29 10% 27.2 23.2 11. T>A(10%) WTSKBR3 Undetermined 24.9 12. NVD WO 2013/123031 PCT/US2013/025913 24 Table 6a: KrasP4 (G12V; G>T) AS-NEPB-PCR on SW480 Cell line DNA: 20ng DNA of SW480 mutant/SKBR3 WT mixtures at three ASP:NEPB ratios were input into the PCR reactions, 0.1% of mixtures equivalent to ~5 copies of mutant. PCR conditions were as stated previously. The ratio of 1:1 gave the best result that 5 reached 0.1% detection sensitivity without non-specific amplification. All of NTC was not undetermined. NEPB Titration/ 5% 1% 0.5% 0.1% WT AS-PCR (CT) No Blocker 28.9 31.2 32.6 33.5 34.2 2:1-ASP:NEPB 28.7 31.1 32.3 34.6 39.9 1:1-ASP:NEPB 29.0 30.9 32.1 34.6 Undetermined 1:2-ASP:NEPB 29.3 31.3 33.3 34.4 Undetermined Actin (Ctri) 22.8 22.8 22.5 23.1 22.8 10 Table 6b: KrasP7 (G13D; 13G>A) AS-NEPB-PCR on HCT116 Cell line DNA: 20ng DNA of HCT116 mutant/SKBR3 WT mixtures with three ASP: NEPB ratios were tested. PCR condition was the same as KrasP4 assay. The ratio of 2:1 or 1:1 reached 0.1% detection sensitivity without non-specific amplification (ratio of 1:1 showed the similar CT value as ratio of 2:1, 1:1 ratio was selected for the 15 further study). All of NTC was not undetermined. NEPB Titration/ 5% 1% 0.5% 0.1% WT AS-PCR (CT) No Blocker 30.6 34.1 33.8 35.0 38.7 2:1-ASP:NEPB 31.4 32.9 35.4 37.6 Undetermined 1:1-ASP:NEPB 31.6 33.9 34.0 36.5 Undetermined 1:2-ASP:NEPB 32.2 33.4 33.8 38.2 Undetermined Actin (Ctri) 22.4 22.8 22.7 22.6 22.9 WO 2013/123031 PCT/US2013/025913 25 Table 7: NEPB and CBO Blocker methods were tested on SW480 and HCT116 Cell line DNA with ASP of KrasP4 and KrasP7: 20ng DNA of each mutant/SKBR3 WT mixtures with 1:1 ratio of ASP: NEPB or 1:4 ratio of ASP: CBO blocker was used the PCR reactions. PCR conditions were as stated previously. NEPB method 5 showed the equivalent, if not better, assay performances as CBO Blocker method; reached 0.1% detection sensitivity without non-specific amplification on WT DNA. All of NTC was not undetermined. K-rasP4 (G12V; 1% 0.5% 5% 1%0.5% 0.1% G>T) WT SW480 SW480 SW480 SW480 AS-PCR (CT) No Blocker 28.9 31.2 32.6 33.0 34.2 1:1-ASP:NEPB 28.6 30.8 32.7 34.2 Undetermined 1:4-ASP:CBO 29.3 31.3 33.3 22.5 Undetermined blocker Actin (Ctrl) 23.1 22.7 22.7 22.8 22.9 10 K-rasP7 (G13V; % 1% 0.5% 5% 1%0.5% 0.1% 13G>A) HCT116 HCT116 HCT116 HCT116 WT(SKBR3) AS-PCR (CT) No Blocker 30.6 34.1 33.8 35.0 38.7 1:1-ASP:NEPB 30.6 33.2 35.0 36.1 Undetermined 1:4-ASP:CBO blocker 30.6 33.2 34.1 37.2 Undetermined Actin (Ctrl) 23.1 22.7 22.7 22.8 22.9 WO 2013/123031 PCT/US2013/025913 26 Table 8: 20ng DNA of HT29 mutant (BRAF V600E)/SKBR3 WT mixtures at various ratios were input into AS-NEPB-PCR. Three NEPB modifications, Phosphate or inverted dT or amino-C7, gave equivalent results. The method detected 0.1% of mutation rate without non-specific amplification. All of Actin Cts were <25 and 5 NTC was not undetermined. Mutan/PCR No Mutant/PCR Phosphate Inverted dT Amino-C7 Blocker Result (CT) 5% 28.9 29.2 28.7 29.0 1% 31.7 31.4 30.7 32.1 0.5% 32.6 33.9 33.2 33.3 0.1% 35.6 35.7 36.7 36.8 WT (SKBR3) 36.1 Undetermined Undetermined Undetermined Table 9: Using AS-NEPB-PCR method, BRAF (V600E) mutations were detected in the two 10 clinical tissue samples (2/42) and one CTC sample (1/42), which were 100% (tissues) or 50% (CTCs), matched with sequencing data. For CTC samples, the mutation only was detected for CTC-196 which had 5 CTCs, but not detected for CTC-220 which had no CTC account based on the analysis of CellSearch system. Non-specific amplification was not observed in both tissue and CTC samples 15 which were confirmed by their sequence data. All of Actin CTS were <25 (data not shown).
WO 2013/123031 PCT/US2013/025913 27 Sample MthdCCI TiseI TiseSqecDaa Tissue PCR data CTC PCR data Mace#T D Tsu D Tsu euneDt (Ct) (Ct) 2 CTC249 8110 N D N D N D 4 CTC209 8086 ND ND ND 5CTC252-,,,, .... 426 .... ... NO: .......... NO N 6 CTC195 5419 ND ND ND . ....... . . . . . . . . . .. . . . . . . . . . 8.......... ...... 54 3.NDND.N 14 CTC 194 5416 N D N D N D 18 CTC201 88084 ND N D ND 23 .. CTC243 .......... NDON 12 CTC220 5414 c.T>A; p.V600E, 80% 30.3 34. 28.... ---4 0 9 DND ND... 34 CTC24 89516 ND ND ND 38.... NT2580 NO95N 39 -CTQ203 ._ _ _ _ .D ND.... ..... A...... 40 CTC218 8112 ND ND ND 41 CTC201 808 ND ND N 20 CTC22 809945 ND 39. ND WO 2013/123031 PCT/US2013/025913 28 Table 10: EGFR Exon 21 L858R (2573 T>G) AS-NEPB-PCR on NCI-H1975 Cell line DNA: 20ng DNA of NCI-H1975 mutant/ NCI-H358 DNA WT mixtures at 1:1 ASP:NEPB ratios were input into the PCR reactions, 0.1% of mixtures equivalent to ~5 copies of mutant. PCR conditions were as stated previously. 0.1% 5 detection sensitivity was reached without non-specific amplification. All of NTC was not undetermined. % Mutant/PCR 5% 1% 0.5% 0.1% WT Result (CT) No Blocker 29.2 29.5 31.0 33.0 35.5 AS-NEPB-PCR 28.3 29.8 31.3 34.2 Undetermined Actin (Ctrl) 22.4 22.9 22.4 22.5 22.3 10
权利要求:
Claims (18)
[1] 1. A method for detecting, in the presence of a wild type sequence, a 5 mutant nucleic acid sequence defined by one or more mutation due to at least one or more of a substitution, a deletion or an insertion at a position while suppressing the signal due to the wild type sequence, the method comprising the steps of: selecting an allele specific primer corresponding to a portion of the 10 mutant nucleic acid sequence such that a 3' end of the allele specific primer aligns with at least one mutated nucleic acid position without a mismatch; selecting an edge-blocker wild type oligonucleotide corresponding to the wild type sequence such that the 3' end of the edge-blocker wild type 15 oligonucleotide has at least one mismatch at or about its 3' end, and, wherein, furthermore maybe similar as CBO method, the 3' end of the edge-blocker wild type oligonucleotide is blocked whereby making it non extendable in a polymerase chain reaction; selecting one or more reverse primers; 20 selecting one or more probes to detect amplification products of the polymerase chain reaction; carrying out the polymerase chain reaction with the ingredients comprising the allele specific primer, the edge-blocker wild type oligonucleotide, the one or more reverse primers and the one or more 25 probes.
[2] 2. The method of claim 1 wherein at least one of the one or more probes is added after the polymerase chain reaction is initiated.
[3] 3. The method of claim 1 wherein the mutant nucleic acid sequence and the 30 wild type sequence are generated with a reverse transcriptase.
[4] 4. The method of claim 1 wherein the one or more mutation includes two adjacent point mutations.
[5] 5. The method of claim 1 wherein the edge-blocker wild type oligonucleotide has a mismatch in at least one of the three base pairs 35 immediately adjacent to its blocked 3' end.
[6] 6. The method of claim 1 wherein the edge-blocker wild type oligonucleotide is equal in length to the allele specific primer.
[7] 7. The method of claim 1 wherein the edge-blocker wild type oligonucleotide is longer than the allele specific primer at its 5' end. WO 2013/123031 PCT/US2013/025913 30
[8] 8. The method of claim 8 wherein the melting temperature of the allele specific primer is - equal or higher than that for the edge-blocker wild type oligonucleotide relative to the wild-type sequence.
[9] 9. The method of claim 8 wherein the melting temperature of the allele 5 specific primer is lower than that for the edge-blocker wild type oligonucleotide relative to the wild-type sequence.
[10] 10. The method of claim 1 wherein the edge-blocker wild type oligonucleotide is present at an equal or lower concentration than the allele specific primer whereby blocking the amplification of the wild type 10 sequence during the polymerase chain reaction.
[11] 11. The method of claim 1 wherein the detection of the mutant nucleic acid sequence includes quantitation to estimate a level of the mutant nucleic acid sequence relative to the wild type sequence.
[12] 12. The method of claim 1 wherein the mutant nucleic acid sequence 15 corresponds to a tumor cell type.
[13] 13. The method of claim 1 wherein the mutant nucleic acid sequence corresponds to a metastatic cell disease.
[14] 14. A diagnostic method for early detection of cancer by way to detecting the presence of one or more mutant cells, in a sample derived from a patient, 20 harboring a mutant nucleic acid sequence in the presence of a wild type cells, the method comprising the steps of: selecting an allele specific primer corresponding to a portion of the mutant nucleic acid sequence such that the 3' end of the allele specific primer does not have a mismatch while being aligned with at least one 25 mutated nucleic acid position; selecting a edge-blocker wild type oligonucleotide corresponding to the wild type sequence such that the 3' end of the edge-blocker wild type oligonucleotide has at least one mismatch at or about its 3' end, and, wherein, furthermore, the 3' end of the edge-blocker wild type 30 oligonucleotide is blocked whereby making it non-extendable in a polymerase chain reaction; selecting one or more reverse primers; selecting one or more probes to detect amplification products of the polymerase chain reaction; 35 carrying out the polymerase chain reaction with the ingredients comprising the allele specific primer, the edge-blocker wild type oligonucleotide, the one or more reverse primers and the one or more probes; and WO 2013/123031 PCT/US2013/025913 31 detecting an early stage of cancer if the mutant nucleic acid sequence is present in the sample.
[15] 15. The method of claim 15 wherein the mutant nucleic acid sequence's presence is detected if amplification products corresponding to it are 5 detected in less than a pre-specified number of amplification cycles.
[16] 16. The method of claim 15 wherein the mutant nucleic acid sequence's presence is detected if amplification products corresponding to it are detected and a reference mutant sequence is not detected in the same sample. 10
[17] 17. The method of claim 1 or 15 wherein the 3' end of the edge-blocker wild type oligonucleotide is blocked from extension in a PCR reaction because it does not have a hydroxyl group.
[18] 18. The method of claim 18 wherein the 3' end of the edge-blocker wild type oligonucleotide is blocked by derivatizing or replacing its 3' hydroxyl 15 group with one or more selected from the group consisting of phosphate, inverted dT and amino-C7.
类似技术:
公开号 | 公开日 | 专利标题
US20160130641A1|2016-05-12|Highly sensitive method for detecting low frequency mutations
Davies et al.2018|Comparison of molecular testing modalities for detection of ROS1 rearrangements in a cohort of positive patient samples
Kawano et al.2006|PIK3CA mutation status in Japanese lung cancer patients
Akca et al.2013|Utility of serum DNA and pyrosequencing for the detection of EGFR mutations in non-small cell lung cancer
US10329605B2|2019-06-25|Method to increase sensitivity of detection of low-occurrence mutations
Jackson et al.2016|Multiplex preamplification of serum DNA to facilitate reliable detection of extremely rare cancer mutations in circulating DNA by digital PCR
Wang et al.2013|Allele-specific, non-extendable primer blocker PCR | for DNA mutation detection in cancer
Herreros-Villanueva et al.2014|KRAS mutations: analytical considerations
Ausch et al.2009|Sensitive detection of KRAS mutations in archived formalin-fixed paraffin-embedded tissue using mutant-enriched PCR and reverse-hybridization
JP2014501533A|2014-01-23|Mutation analysis
Chang et al.2010|Detection of N-, H-, and KRAS codons 12, 13, and 61 mutations with universal RAS primer multiplex PCR and N-, H-, and KRAS-specific primer extension
Araki et al.2010|Usefulness of peptide nucleic acid |-clamp smart amplification process version 2 | for clinical diagnosis of KRAS codon12 mutations in lung adenocarcinoma: Comparison of PNA-clamp SmartAmp2 and PCR-related methods
CN104805207A|2015-07-29|Kit for detecting kras gene mutation, and detection method of kit
AU2021202766A1|2021-05-27|Method of preparing cell free nucleic acid molecules by in situ amplification
US20160153058A1|2016-06-02|Methods of performing polymerase chain reaction and related uses thereof
JP2019519540A|2019-07-11|Novel Mutations in Anaplastic Lymphoma Kinase to Predict Response to ALK Inhibitor Therapy in Lung Cancer Patients
Chen et al.2014|High-sensitivity PCR method for detecting BRAF V600Emutations in metastatic colorectal cancer using LNA/DNA chimeras to block wild-type alleles
Machnicki et al.2013|ARMS-PCR for detection of BRAF V600E hotspot mutation in comparison with Real-Time PCR-based techniques.
US20190382848A1|2019-12-19|Primers, Methods and Kits for Diagnosing and Predicting Therapy Response of Cancers by Cold-PCR Based Amplification of Mutation-Rich Regions of KRAS, EGFR and P53
EP3350347B1|2021-01-20|Methods and materials for detection of mutations
KR102278401B1|2021-07-19|Methods for rapid and sensitive detection of hotspot mutations
Chang et al.2014|Detection of KRAS codon 12 and 13 mutations by mutant-enriched PCR assay
CN107354197B|2020-10-27|Kit for detecting human NRAS gene mutation
US20160160297A1|2016-06-09|Methods and compositions for detecting mutations in the human pi3kca | gene
JP6153758B2|2017-06-28|Polymorph detection probe, polymorph detection method, drug efficacy determination method, and polymorph detection kit
同族专利:
公开号 | 公开日
WO2013123031A3|2015-03-12|
US20160130641A1|2016-05-12|
EP2814985A2|2014-12-24|
IL234021D0|2014-09-30|
EP2814985A4|2016-03-30|
WO2013123031A2|2013-08-22|
JP2015517798A|2015-06-25|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题
AU2002233540A1|2001-02-23|2002-09-12|Pyrosequencing Ab|Allele-specific primer extension assay|
WO2010046067A1|2008-10-20|2010-04-29|Roche Diagnostics Gmbh|Improved allele-specific amplification|
CN103911428B|2009-03-27|2016-02-24|生命技术公司|For detecting the method for allele variant, composition and test kit|DK3023788T3|2010-05-14|2020-04-27|Massachusetts Gen Hospital|Compositions of tumor-specific neoantigens for use in the treatment of tumors|
US10801070B2|2013-11-25|2020-10-13|The Broad Institute, Inc.|Compositions and methods for diagnosing, evaluating and treating cancer|
EP3234193B1|2014-12-19|2020-07-15|Massachusetts Institute of Technology|Molecular biomarkers for cancer immunotherapy|
EP3757211A1|2014-12-19|2020-12-30|The Broad Institute, Inc.|Methods for profiling the t-cell-receptor repertoire|
CN107849606A|2015-04-20|2018-03-27|尼欧基因组学实验室股份有限公司|The method for improving sequencing sensitivity of future generation|
KR20180010229A|2015-05-20|2018-01-30|더 브로드 인스티튜트, 인코퍼레이티드|Shared neointimal antigen|
US10227657B2|2015-07-01|2019-03-12|Neogenomics Laboratories, Inc.|Method for high sensitivity detection of MYD88 mutations|
WO2017031230A1|2015-08-17|2017-02-23|Neogenomics Laboratories, Inc.|High-sensitivity sequencing to detect btk inhibitor resistance|
WO2018067872A1|2016-10-05|2018-04-12|Abbott Laboratories|Devices and methods for sample analysis|
US10894975B2|2016-12-09|2021-01-19|Plexbio Co., Ltd.|Image differentiated multiplex assays for multiplex detection of DNA mutations|
US20190376147A1|2017-01-24|2019-12-12|The Broad Institute, Inc.|Compositions and methods for detecting a mutant variant of a polynucleotide|
CN108676845A|2018-04-13|2018-10-19|深圳蓝图基因科技有限公司|The method for shearing not mutated target spot using CRISPR technologies to highlight low frequency mutation|
法律状态:
2018-02-08| MK5| Application lapsed section 142(2)(e) - patent request and compl. specification not accepted|
优先权:
申请号 | 申请日 | 专利标题
US201261599074P| true| 2012-02-15|2012-02-15||
US61/599,074||2012-02-15||
PCT/US2013/025913|WO2013123031A2|2012-02-15|2013-02-13|Highly sensitive method for detecting low frequency mutations|
[返回顶部]